|
 |
| PHARMACOLOGICAL STUDY |
|
| Year : 2018 | Volume
: 39
| Issue : 3 | Page : 169-181 |
|
|
Influence of intrinsic microbes on phytochemical changes and antioxidant activity of the Ayurvedic fermented medicines: Balarishta and Chandanasava
Annadurai Vinothkanna, Soundarapandian Sekar
Department of Industrial Biotechnology, School of Biotechnology, Bharathidasan University, Tiruchirappalli, Tamil Nadu, India
| Date of Web Publication | 29-Mar-2019 |
Correspondence Address:
Dr. Soundarapandian Sekar
Department of Industrial Biotechnology, School of Biotechnology, Bharathidasan University, Tiruchirappalli - 620 024, Tamil Nadu
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/ayu.AYU_237_17
 Abstract | | |
Background: Balarishta and Chandanasava are polyherbal-fermented medicines of Ayurveda. Objective: Investigation of native microbes, understanding phytochemical changes and antioxidant activities in these medicines. Methods: Microbial populations were enumerated using selective media and standard plating methods. Yeast and bacteria were identified using classical and molecular methods. Qualitative phytochemical and gas chromatography-mass spectrometry (GC-MS) analyses were carried out.In vitro antioxidant assays were performed with different assay systems. Results: Balarishta and Chandanasava possess two yeasts (Saccharomyces cerevisiae and Schizosaccharomyces pombe) and six bacteria that are species of Bacillus, Paenibacillus, and Brevibacillus. These microbes identified biochemically were authenticated with 16S and 18S rDNA sequence analysis and NCBI accession numbers. GC-MS analysis indicated that several compounds disappear as a result of fermentation while many are retained. The presence of new phytochemical compounds in the final stages of fermentation could be ascribed from the parent molecules that either disappeared or retained during fermentation. It suggests the biotransformation of phytochemicals by the mediation of intrinsic microbes. These medicines possess antioxidant activities by the presence of phytochemicals such as phenolics, flavonoids, tannins and phytosterols, wherein bacteria also contribute. Conclusion: The role of native microbial consortium in fermentation, biotransformation and antioxidant activity of these Arishta and Asava is demonstrated.
Keywords: 16S and 18S rDNA analysis, antioxidant activity, biotransformation, gas chromatography-mass spectrometry analysis, traditional knowledge
How to cite this article:
Vinothkanna A, Sekar S. Influence of intrinsic microbes on phytochemical changes and antioxidant activity of the Ayurvedic fermented medicines: Balarishta and Chandanasava. AYU 2018;39:169-81 |
How to cite this URL:
Vinothkanna A, Sekar S. Influence of intrinsic microbes on phytochemical changes and antioxidant activity of the Ayurvedic fermented medicines: Balarishta and Chandanasava. AYU [serial online] 2018 [cited 2023 Jun 9];39:169-81. Available from: https://www.ayujournal.org/text.asp?2018/39/3/169/255252 |
| Introduction | |  |
Ayurvedic pharmacopeia comprises various medicines including fermented traditional medicines (FTM), namely, Arishta (fermented decoctions) and Asava (fermented infusions). They are polyherbal preparations fermented by self-generated/intrinsic microbes. They are moderately alcoholic and prepared using herbal juices or their decoctions to undergo fermentation by the addition of sugar, jaggery or honey.[1] Conventionally, Arishta and Asava are considered as unique and valuable therapeutics[2] because of their better keeping quality, enhanced therapeutic properties, improvement in the extraction of drug molecules from the herbs and effectiveness of drug delivery in the body. There are at least 44 Arishta and 45 Asava preparations whose composition and medicinal properties were documented earlier.[1],[2],[3] Among them, Balarishta and Chandanasava are commonly used ones. Balarishta is recommended for paralysis, nervous disorders, gastric problems, autoimmune diseases and rheumatism. It contains 11 herbal ingredients. Chandanasava contains 24 herbal ingredients and is recommended for treating ailments such as gastric problems, urinary disorders, spermatorrhea, gonorrhea, autoimmune diseases and as diuretic, appetizer and to provide cooling effect in the body.[1]
There are few reports on the isolation of microbes from this fermentation system. For example, Saccharomyces from Amritarishta,[4] yeasts, Aspergillus and Bacillus species from Dashamularishta,[5]Saccharomyces cerevisiae and Schizosaccharomyces pombe from Nimbarishta.[6] As in other medicaments of Ayurveda, investigation on the phytochemical composition of Arishta and Asava are also scanty and earlier reports indicate only the presence or absence of certain preliminary groups of phytochemicals.[7],[8],[9],[10],[11],[12],[13],[14],[15] There are also few reports on the specific phytochemical components in the group of phenolics, stilbenes, glucosides and non-volatile compounds.[16],[17] The situation in Arishta/Asava could be complex as microbial fermentation is involved and every feasibility of interaction of the herbal-oriented phytochemicals with the microbial catalyst exists. There are also few reports on the possibility of biotransformation of phytochemicals-phenolics biotransformation in Arjunarishta and Abhayarishta[16],[18] and glucoside biotransformation in Jirakadyarishta.[19] It is thus evident that microbiological studies in Ayurvedic Arishta and Asava are in the nascent stage. The range of microbial catalysts involved in the entire Arishta and Asava fermentations and their possible succession in different stages need systematic investigation. The analysis of sequence-based evolutionary relationship among the closely related species of 18S rDNA genes of yeasts and 16S rDNA genes of bacteria can be helpful to ascertain their identity.[20] Recently, the antioxidant activity of Balarishta,[8],[21],[22]Saraswatarishta,[12]Ashwagandharishta[23] and Kumaryasava[24] were documented. Antioxidants have numerous pharmaceutical and therapeutic roles to play. Formation of free radicals is the causative factor for several diseases and quenching them by antioxidants leads to health.[25] However, synthetic antioxidants cause side effects and search for natural antioxidants that lack toxicity is the need of the hour.[25] Hence, this work is to evaluate the microbiota emerged during fermentation and their contribution to phytochemical changes and antioxidant property of Balarishta and Chandanasava.
| Materials and Methods | | |
Chemicals and reagents
The chemicals for phytochemical analysis, antioxidant assays and standards were purchased from Himedia (Mumbai, India), Sisco Research Lab (Mumbai, India) and Sigma–Aldrich (St. Louis, Missouri, USA). Chemicals, reagents and solvents used were of analytical grade.
Preparation of Balarishta and Chandanasava
The Ayurvedic samples were prepared from the manufacturing unit of M/S. Ashtanga Ayurvedics (P) Ltd, Tiruchirappalli, Tamil Nadu, India [Table 1]. The herbal ingredients were sourced directly from this Ayurvedic firm.
Balarishta is made with decoctions of herbs in boiling water, while Chandanasava is prepared directly using fresh herbal juices.[1] In the preparation of Balarishta, decoction of drug is prepared and placed in an earthen fermentation vessel. Jaggery is dissolved, boiled and added into the fermentation vessel. Fermentation of worts of both the formulation is traditionally brought about by the addition of flowers of the plant, Woodfordia fruticosa (L.) kurz. Then, the earthen lid edges are closed with clay smeared cloth. Constant temperature (28°C) is maintained during fermentation. The fermented fluid is finally filtered and used. For Chandanasava preparation, the required quantity of water to which jaggery and sugar are added, boiled and cooled. This is poured into the fermentation vessel in that the fine powdered herbal drugs are added. Further processing is performed as in Balarishta.
Microbiological evaluation
Enumeration of microorganisms
The samples were decimally diluted (10−1, 10−2-10−5) using sterile 0.85% saline water in 1: 9 ratio. One milliliter of each diluted sample was pour plated using actidione-incorporated nutrient agar (for heterotrophic bacteria),[26] chloramphenicol-incorporated yeast extract-malt extract agar (for yeasts)[27] and chloramphenicol-incorporated dichloron rose bengal agar (for fungi).[28] The total heterotrophic bacterial population (grown at 37°C), yeast (grown at 28°C) and fungal (grown at 30°C) population were enumerated after 42-72 h of growth. Discrete microbial colonies were isolated and purified for further identification.
Biochemical and molecular identification of yeasts using 18S rDNA sequencing
The yeasts were identified using classical biochemical tests such as fermentation of carbohydrates (glucose, sucrose, melibiose, lactose, raffinose, maltose and cellobiose), growth in various carbohydrates and temperatures, urea hydrolysis and reproduction.[27] For 18S rDNA, genomic DNA was isolated with Fungal Genomic DNA Isolation Kit (RKT13, Chromous Biotech, Bengaluru) using pure cultures and amplified internal transcribed spacer (ITS) region of the 18S rDNA genes using universal primers ITS1 (5'-ACCCGCTGAACTTAAGC-3') and ITS2 (5'-TACTACCACCAAGATCT-3') by polymerase chain reaction (PCR).[29],[35] The PCR was carried out by denaturing DNA initially at 94°C for 5 min followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min and final extension at 72°C for 10 min). The presence or absence of PCR products was determined electrophoretically on 1% (w/v) agarose gel with ethidium bromide staining. The PCR products were purified using a Gel Extraction Kit (Qiagen, California, USA) and subcloned into pGEMT-Easy vector (Promega, Wisconsin, USA). The selected clone was subjected to sequencing of 18S rDNA gene fragment with universal primer SP6 (ATTTAGGTGACACTATAGAAGNG) and T7 (TAATACGACTCACTATAGGGAGA) using ABI prism 3130 sequencer (Perkin Elmer, California, USA). The sequence data were aligned with nucleotide PSI-BLAST[30] to identify the closely related organisms and to recognize the origin and evolution among them. Pair-wise and multiple sequence alignment were done by CLUSTAL W.[31] The construction of phylogenetic tree and computing the pair-wise genetic diversity for the yeast isolates was performed based on sequence similarities using molecular evolutionary genetics analysis (MEGA) Version 6.0 software[32] employing neighbor joining[33] method of Kimura two-parameter evolutionary model with 1000 bootstrap replicates.[34]
Biochemical and molecular identification of bacteria using 16S rDNA sequencing
The bacterial cultures were identified by biochemical tests (Bergey's Manual of Systematic Bacteriology, 1984) such as ram staining, endospore staining, motility, catalase test, fermentation of carbohydrate, indole test, the hydrolysis of starch, casein and gelatin, Voges-Proskauer test, citrate utilization and nitrate reduction.[35] For 16S rDNA, genomic DNA was isolated from the pure culture[29] and 16S rDNA was amplified using universal primers (FD1-'-GAGTTTGATCCTGGCTCAG-3 ' and RD1-5'-AAGGAGGTGATCCAGCC-3'). PCR was carried out by denaturing DNA initially at 94°C for 5 min followed by 30 cycles of amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 2 min). The PCR amplified products were electrophoresed on 1% agarose gel. The PCR products were purified using a Gel Extraction Kit (Qiagen, California, USA) and subcloned into pGEM-T Easy vector (Promega, Wisconsin, USA). The selected clone was subjected to sequencing of 16S rRNA gene fragment with universal primer SP6 (ATTTAGGTGACACTATAGAAGNG) and T7 (TAATACGACTCACTATAGGGAGA) using ABI prism 3130 sequencer (Perkin Elmer, California, USA).[36] Phylogenetic analysis of the sequence data (PSI-BLAST, CLUSTAL W and MEGA) was performed as in the case of yeasts.
Phytochemical evaluation
Qualitative analysis of phytochemicals
The preliminary phytochemicals were evaluated up to 35 days in 5-day intervals during the course of fermentation.[37] Alkaloids were analyzed using Dragendorff's reagent and saponins by foaming test[38] glycosides were assessed by analyzing the total sugar content of the sample,[39] before and after hydrolysis with concentrated sulfuric acid,[38] tannins using lead acetate reagent, phenolic compounds using ferric chloride reagent, phytosterols using acetic anhydride-sulfuric acid reagent and flavonoids using lead acetate reagent.[40]
Gas chromatography-mass spectrometry analysis of phytochemicals
Arishta and Asava samples were concentrated in hot air oven at 80°C for 24-48 h. Fifteen milliliters of this sample was frozen using the deep freezer for 1 day at –20°C and then, the frozen sample was concentrated with the help of vacuum evaporator at –80°C. The freeze-dried sample was dissolved in 10 ml of HPLC grade methanol and gas chromatography-mass spectrometry (GC-MS) (PerkinElmer Clarus 500, Connecticut, USA) analysis was performed.[41] One micro liter of sample (Balarishta and Chandanasava separately) was injected (split ratio 1:8) into the GC-MS system on a 30-m capillary column with a film thickness of 0.25 μm (30 mm × 0.25 mm id coated with 5% phenyl 95% dimethylpolysiloxane). Helium was the carrier gas with a flow rate of 1 ml/min. The injection port temperature was 280°C. Two types of oven temperature were followed. Initial oven temperature of 50°C at 10°C/min to 150°C at 8°C/min to 280°C (10 min) and 60°C at 8°C/min to 200°C at 10°C/min to 300°C (5 min) (Scan type: full scan mode, Scan range: 40-450 Daltons). The peaks are matched with phytochemistry library: NIST (The National Institute of Standards and Technology) MS search library version 2.0.
Pharmaceutical evaluation
Antioxidant assays
The antioxidant activity of Balarishta, Chandanasava, and microbial cell-free supernatant (CFS) were measured by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity,[23],[42] hydroxyl radical scavenging,[42],[43] hydrogen peroxide scavenging,[23] reducing power,[23],[42] metal chelating assay,[43],[44] nitric oxide scavenging,[43] superoxide anion[43],[44] and 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid [ABTS]) radical scavenging assay.[45] (Jasco V-650, Tokyo, Japan).
Statistical analyses
The data were represented as mean ± standard error of mean of three determinations. Statistical analyses were performed using one-way analysis of variance. The IC50 values were calculated by linear-regression probit analysis. Results were calculated by employing the statistical software (SPSS for Windows, Version 16.0. Chicago, SPSS Inc.).
| Results | | |
Microbiological evaluation
The population of bacteria, yeast, and fungi was investigated during the entire course of fermentation of Balarishta [Figure 1]a and Chandanasava [Figure 1]b. In both Chandanasava and Balarishta, filamentous fungi were found only at the beginning stages of fermentation that too at low levels over the surface. They disappeared from the fifth day in Balarishta and tenth day in Chandanasava. In Balarishta, yeasts are the dominant population found throughout the course of fermentation (25,700 × 103 CFU/ml). The population was at its peak on the fifth day and subsequently decreased toward the end of fermentation [Figure 1]a. However, in Chandanasava, though yeasts were dominant (9500 × 103 CFU/ml), they disappeared after twenty fifth day. The peak of yeast population was found on fifth and tenth days. Next to yeasts, the presence of bacteria was also observed in this fermentation process [Figure 1]b. In Balarishta, the bacterial population gradually increased up to tenth day and subsequently maintained at steady level (71 × 103 CFU/ml) till the end of fermentation [Figure 1]a. But, in Chandanasava, the bacterial population was at its peak on the fifth day (188 × 103 CFU/ml). It decreased, but fluctuated till the end of fermentation [Figure 1]b. Investigation of yeast population indicated the presence of two kinds that are similar in both Balarishta and Chandanasava. Both organisms have the same colony morphology – creamy white and circular colonies. Microscopic examination revealed the presence of budding yeast and fission yeast. | Figure 1: Enumeration of microbial population during the course of fermentation of (a) Balarishta and (b) Chandanasava
Click here to view |
Identification of budding yeast (BY-03) by morphological and biochemical features [Table 2] revealed as S. cerevisiae. Similar identification of fission yeast (BY-10) revealed as S. pombe [Table 1]. The bacteria present in the Balarishta fermentation was investigated morphologically and biochemically [Table 3]. It revealed the presence of six species of Bacillus (Bacillus licheniformis, Bacillus macerans, Bacillus pumilus, Bacillus subtilis and Bacillus circulans). Similarly, in Chandanasava, six species of Bacillus (B. licheniformis, B. subtilis, B. polymyxa, B. coagulans, B. circulans and B. mycoides) were present [Table 3]. | Table 2: Biochemical characterization leading to the identification of yeasts involved in the fermentation of Balarishta and Chandanasava
Click here to view |
 | Table 3: Biochemical characterization leading to the identification of bacteria involved in the fermentation of Balarishta and Chandanasava
Click here to view |
Occurrence of bacterial flora in the suspension of Balarishta and Chandanasava during the entire course of fermentation was recorded. In Balarishta, B. pumilus was constantly present, while other five species had a sporadically present during the full course of fermentation. B. licheniformis was noticed in the fermentation mash on 0, 15, 20, 25 and 35 days. B. brevis was found on 0, 10 and 20 days. B. circulans was found on 5, 20 and 30 days. B. subtilis was observed on 5, 10 and 30 days. Finally, B. macerans was found on 0, 5 and 10 days. In Chandanasava, B. licheniformis and B. subtilis were constantly present while another four species showed the sporadic presence during the full course of fermentation. B. polymyxa and B. coagulans were found only at the initial day of fermentation and absent subsequently. B. mycoides was noticed only on twentieth day, while B. circulans was found only on 15, 20 and 30 days of fermentation.
Budding yeast (BY-03) was identified by 18S rDNA as S. cerevisiae (Accession number: KJ562355) [Table 4]. Similarly, fission yeast (BY-10) was identified as S. pombe (Accession number: KJ562356) [Table 4]. The Homologs template sequences were retrieved from NCBI-BLAST based on the similarity analysis from our target isolates of 12 bacteria and 2 yeasts [Table 3]. Identification of 12 bacteria by 16S rDNA revealed some differences from the classical biochemical tests based approaches, [Table 4] wherein the organisms fit into species of Bacillus, Paenibacillu, or Brevibacillus. Using neighbor-joining algorithm, the phylogenetic tree was constructed with 1000 bootstrap replication [Figure 2]. The phylogenetic tree was grouped into two major clusters. Cluster one belongs to S. cerevisiae and cluster two belongs to S. pombe. The sequence-based evolutionary relationship among the strains of S. cerevisiae shows no diversity occurrence at the species level. Our target sequence S. cerevisiae BY-03 is closely related with S. cerevisiae Sc20. Whereas, S. pombe BY-10 are closely related with the genera Schizosaccharomyces UFLA [Figure 3]. From this result, the closely related species were placed as a reference model for the target species. | Table 4: Similarity search analysis of rRNA gene sequences of bacteria (16S) and yeasts (18S) isolated from Balarishta and Chandanasava using NCBI-BLAST
Click here to view |
 | Figure 2: Phylogenetic tree based on 16S rDNA genes of the 12 bacterial isolates. The numbers at nodes are percentages indicating the levels of bootstrap support, based on neighbor joining method. ♦ Represents bacterial isolates from Balarishta. • Represents bacterial isolates from Chandanasava
Click here to view |
 | Figure 3: Phylogenetic tree based on 18S rDNA genes of the two yeast isolates (BY-03 and BY-10). The numbers at nodes are percentages indicating the levels of bootstrap support, based on neighbor joining method
Click here to view |
Phytochemical evaluation
Preliminary phytochemical changes
Qualitative analysis of phytochemicals during the process of fermentation of Balarishta indicated some major changes, though alkaloids, tannins, phenolic compounds and glycosides were present during the entire course of fermentation. Flavonoids and saponins were found from fifth-day onward, whereas phytosterol from the tenth-day onward. Similar phytochemical changes in Chandanasava showed the presence of alkaloids, tannins, phenolic compounds, saponins and glycosides in the entire course of fermentation. Further, phytosterols and flavonoids were found from fifth day onward.
Specific phytochemical changes
To ascertain the nature of phytochemicals, GC-MS analysis was performed using two types of oven temperature programs, both at the initial and final stages of fermentation in Balarishta and Chandanasava. The compounds identified at the start of fermentation and at the end of fermentation are listed out, respectively, for Balarishta and Chandanasava. Analysis of these results indicated that certain compounds are retained during the entire course of fermentation while many disappear. Similarly, formation of new compounds can be traced. Based on this GC-MS analysis, there are 19 compounds retained during the entire course of fermentation of Balarishta. Further, 18 compounds are known to disappear and 23 compounds are newly formed as a result of fermentation [Table 5]. In the case of Chandanasava, 14 compounds are retained during the entire course of fermentation. Further, 30 compounds are known to disappear and 32 compounds are newly formed as a result of fermentation [Table 6]. | Table 5: Phytochemicals that are retained, disappeared and newly formed as a result of fermentation of Balarishta
Click here to view |
 | Table 6: Phytochemicals that are retained, disappeared and newly formed as a result of fermentation of Chandanasava
Click here to view |
Pharmaceutical evaluation
Antioxidant activity
Both Balarishta and Chandansava exhibited considerable antioxidant activities. It was assayed in terms of scavenging of free radicals (DPPH, HRSA, hydrogen peroxide, ABTS, nitric oxide and superoxide anion), inhibition of free radical generation by metal chelation [Table 7] and assessing the reducing power [Figure 4]. In DPPH assay, IC50 value of Balarishta (250.48 μl/ml) and Chandanasava (442.99 μl/ml) were higher when compared to the standard, L-ascorbic acid (210.31 μg/ml) [Table 7]. It indicated that Chandanasava has low DPPH scavenging activity compared to Balarishta. Similar trend was observed in hydroxyl, nitric oxide and superoxide anion radicals scavenging assays [Table 7]. However, in hydrogen peroxide scavenging assay, Chandanasava (56.57 μl/ml) performed better than Balarishta (69.22 μl/ml), yet their performance was less than the standard L-ascorbic acid (30.09 μg/ml). Similar trend was observed in ABTS scavenging and metal chelating assay also [Table 7]. However, the efficacy of Chandanasava in ABTS scavenging assay was comparable to the standard. In reducing power assay, both Balarishta and Chandasava were less compared to the standard. Among them, Balarishta exhibited better reducing power ability than Chandasava [Figure 4]. | Figure 4: Reducing power of Balarishta and Chandanasava. Values are represented as mean ± standard error of mean (n= 3). *P < 0.05, **P < 0.01 and ***P < 0.001 versus control. Ascorbic acid is the standard (μg/ml)
Click here to view |
It is important to note that CFSs of bacteria obtained from Balarishta and Chandansava also exhibited antioxidant property. However, the activity was less when compared to the standards in all the assays [Table 8]. In DPPH assay, among the bacterial isolates of Balarishta, BB-14 (62.6%) showed highest free radical scavenging ability. Similar trend was observed in hydroxyl radical scavenging assay also. In ABTS assay, BB-04 (75.56%) performed better in scavenging. In nitric oxide and metal chelating assays, BB-01 was better. Similarly, BB-24 was better in superoxide anion and reducing power [Table 8]. | Table 8: Antioxidant activity of cell-free supernatant of bacteria isolated from Balarishta and Chandanasava
Click here to view |
In Chandanasava, scavenging of DPPH radical was better in CB-31 (70.03%). CB-03 showed better hydroxyl radical scavenging ability among the isolates. In ABTS, nitric oxide and metal chelating assays, CB-24 exhibited the highest activity followed by others [Table 8]. CB-51 had higher superoxide anion radical scavenging and H+ donating ability (reducing power).
| Discussion | | |
The profile of enumerated microorganisms reveals that yeasts and bacteria are the major players in the fermentation of both Balarishta and Chandanasava. The disappearance of filamentous fungi at the early stages of fermentation in both cases indicates that they have no role to play in the fermentation process. Moreover, yeasts are well known for their ability of alcohol production. It is possible that either yeasts or bacteria or their combination consortia could be the biocatalysts for the biotransformation of phytochemicals present in both preparations. It is important to note that there are two kinds of yeasts S. cerevisiae and S. pombe coupled with six different species of bacilli that are present in both Balarishta and Chandanasava.
In this study, the profile of bacteria changes with the progression of fermentation. Although both yeasts are commonly present, the species of Bacillus showed dynamic changes during the course of fermentation. Similarly, in Kutajarishta, microbial composition at initial stages of fermentation was assessed by culture-independent 16S rDNA gene clone library approach.[14] At the initial stage of fermentation, Lactobacillus sp., Acinetobacter sp., Alcaligenes sp. and Methylobacterium sp. were recovered but were not detected on the eighth day of fermentation. Initially, microbial diversity increased after 8 days of fermentation with 11 Operational Taxonomic Units (OTUs), which further decreased to 3 OTUs at 30 days of fermentation. Aeromonas sp., Pseudomonas sp. and Klebsiella sp. dominated till the thirtieth day of fermentation.
Herbal materials were indicated as a source of bacterial species.[46] Dried flower buds of W. fruticosa (an ingredient) were reported as a source of Aspergilus sp. cocci and rod-shaped bacilli[4] as well as Rhizopus nigricans and Aspergillus niger.[47] Addition of W. fruticosa was known to increase the content of alcohol.[48],[49] From commercial Nimbarishta, S. cerevisiae Hansen and S. pombe Lindner var. pombe were reported to be isolated.[6]Saccharomyces species were also isolated and characterized from Amritarishta.[4] Two species of yeasts were isolated from Dashamularishta along with Aspergillus and Bacillus species.[5] The phylogenetic analysis supported the identification of ancestral and closely related species of Saccharomyces, Schizosaccharomyces, and the different species of Bacillus, Paenibacillus or Brevibacillus in both Balarishta and Chandanasava.
Qualitatively, Balarishta and Chandanasava have various secondary metabolites. Such phytochemical analysis in various Arishta and Asava indicated the presence of secondary plant metabolites such as phenols, flavonoids, terpenoids, glycosides, steroids, alkaloids, tannins, saponins and various alcohols and related compounds.[7],[8],[9],[10],[11],[12],[13],[14],[15] However, certain compounds such as flavonoids, saponins and phytosterols form at a later stage in the course of fermentation as evident in Balarishta and Chandanasava predicting the role of microorganisms present in.
The plethora of chemicals present in the final product would also have been formed as a result of microbial biotransformation. It is supported by the observation that in Balarishta, 18 compounds disappeared as a result of fermentation while 23 compounds are newly formed. In addition, 19 compounds are retained from the beginning up to the final product. In the case of Chandanasava, 30 compounds disappeared as a result of fermentation while 32 compounds are newly formed. In addition to this, 14 compounds are retained from the beginning to the final product. Particularly, newly formed chemicals could have been formed from disappearing compounds or from the retained compounds.
In jujube Asava prepared in Japan, hydrolysis of glycosides is known as a result of fermentation (benzyl alcohol from zizybeoside I or II present in jujube).[50] In Abhayarishta, the major polyphenolics (Chebulagic and Chebulinic acid) were hydrolyzed to their respective monomers indicating biotransformation and consequently, there was an increase in the amount of chebulic acid, gallic acid, ellagic acid and ethyl gallate after fermentation.[18] In Jirakadyarishta, selective hydrolysis of 7-O-glucosides of luteolin and apigenin during fermentation resulted in an increase in the amount of luteolin and apigenin indicating biotransformation.[19] In Arjunarishta, the possible hydrolysis of ellagitannins and gallotannins during fermentation, resulting in an increase in the concentration of monomeric phenolics indicating biotransformation.[16]
In our studies also, the possible biotransformation of phytochemicals and their reactions could be chemically assessed. In the case of Balarishta, for example, the formation of 2,3-butanediol from oxirane, 2,3-dimethyl-trans is feasible by hydroxylation. Similarly, the formation of three other biotransformed compounds in the final product could be chemically supported from the source compounds [Table 9]. It could be possible by reactions such as removal of water, hydrolysis of ester and reduction of the carbonyl group as warranted in the biotransformation reactions. Similarly, in the case of Chandanasava, the possible biotransformation of eight such phytochemicals with their reactions is indicated [Table 10]. Here also, chemical reactions involving removal of the hydroxyl group, ketoenol tautomerism, isomerization, deacetylation, ester hydrolysis etc., could be implicated as the basis for biotransformation reactions. Such reactions could have been mediated by the intrinsic microflora of microorganisms acquired during fermentation. | Table 9: Feasible biotransformation reactions in Balarishta based on the changes in the profile of compounds upon fermentation as identified by GC-MS analysis
Click here to view |
 | Table 10: Feasible biotransformation reactions in Chandanasava based on the changes in the profile of compounds upon fermentation as identified by GC-MS analysis
Click here to view |
Antioxidants are molecules or systems that inhibit or quench free radicals or interrupt propagation of the free radicals generated by reactive species.[25] It is extensively reported that several diseases are caused due to the oxidative stress generated by reactive oxygen species (ROS). Endogenous antioxidants are very delicate because the imbalance between overproduction of ROS and less neutralization ability of free radicals which results cellular damage.[51] Researchers reported that synthetic antioxidants are helpful to inhibit the free radicals generation, but it causes side effects leading to several diseases.[25] In this regard, there is a need to search natural antioxidants which are believed to scavenge free radicals and also considered as safe.
DPPH radical is a stable organic molecule and useful in the investigation of free radical scavenging by antioxidants and hence used primarily in the assay system.[52] Hydroxyl radicals are potent ROS that react with polyunsaturated fatty acid and moieties of cell membrane phospholipids and cause damage to cells.[53] Hydrogen peroxide generates extremely reactive hydroxyl radicals in the presence of transition metal ions such as iron and copper, rapidly cross the cell membranes and pose higher toxicity to cells.[24] ABTS radical scavenging activity is based on the transfer of hydrogen atoms and electrons.[45] Superoxide radicals are most harmful radical because they are the precursors for other major ROS.[45] Nitric oxide radical is generated from L-arginine metabolism by nitric oxide synthases and are toxic to biological tissues. The toxicity is increased, when NO radicals react with superoxide radical to form a highly reactive peroxynitrite anion (ONOO−).[52] Reduction of Fe3+ to Fe2+ indicates the presence of reductones (antioxidants) which reflects scavenging of free radicals by donating a hydrogen atom.[54] Iron is vital for carrying oxygen, respiration and for enzymatic activity. It can initiate lipid peroxidation by Haber–Weiss and Fenton reactions leading to the generation of superoxide anion and hydroxyl radicals.[53] Ferrous ion chelating agents inhibit lipid peroxidation (by stabilization of transition metal), free radical generation, and resultant oxidative damage.[54] Both the Arishta/Asava and bacterial CFS exhibited good amount of antioxidant activity in terms of scavenging the free radicals in the assay systems such as DPPH, hydroxyl, hydrogen peroxide, ABTS, nitric oxide and superoxide anion in addition to metal chelating and reducing power.
The profile of phytochemicals present in both Balarishta and Chandanasava such as phenolic compounds, tannins, flavonoids and phytosterol can harbor antioxidant compounds. GC-MS analysis also showed the presence of antioxidant compounds such as squalene, trans-squalene and lupeol (triterpenes), ß-sitosterol, (20R)-cholest-4-en-3-on, stigmasterol (phytosterols), 2-methoxy-4-vinylphenol (phenolics) and n-hexadecanoic acid (saturated fatty acid). ROS, reactive nitrogen species and reactive sulfur species have been linked to several diseases such as cancer, atherosclerosis, stroke, neurological disorders, renal disorders, rheumatoid arthritis, autoimmune diseases, inflammation and gastric ulcers.[51]
The antioxidant activity of Balarishta and Chandanasava was found to be less compared to the standards. It could be explained that standards are pure chemical forms, but the Balarishta and Chandanasava are chemically heterogeneous in nature. Moreover, the recommended dosage of consumption is around 15-30 ml twice per day. This may provide a considerable antioxidant support to the consumer of such Arishta and Asava.[23],[24] Interestingly, the intrinsic microbes involved in the fermentation of Balarishta and Chandanasava also contribute for the antioxidant property of these medicines.[42] This will explain the traditional claim on the medicinal properties of Balarishta and Chandanasava. In addition to this, antioxidant compounds such as lupeol present in Balarishta also demonstrated to exhibit bioactivities such as anti-inflammatory (ameliorates rheumatism), anti-arthritic (ameliorates autoimmunity),[55] anti-ulcerogenic action (ameliorates gastric problems) and antinociceptive (ameliorates nervous disorders).[56] Presence of such compounds additionally reasons out the therapeutic property of such Arishta.
The better shelf-life-enhanced therapeutic properties, improvement in the extraction of drug molecules from the herbs and improvement in drug delivery of Arishta and Asava could be ascribed to the fermentation and biotransformation reactions mediated by the intrinsic microflora of these FTM. They also contribute to the antioxidant property of these medicines likely by the generation and sequestration of specific compounds. The plant materials act as a source of bioactive phytochemicals but microbes contribute for the increase in the bioactivity like antioxidant property.
| Conclusion | | |
The study indicated the presence of intrinsic microbes such as yeasts and bacilli that collectively function as a consortium. Dynamic changes in the profile of microbiota do occur during the course of this fermentation. These intrinsic microbes not only mediate fermentation but also perform biotransformation of phytochemicals. The profiles of phytochemicals are proven antioxidants. Moreover, the bacterial supernatants also exhibit antioxidant activity. Thus, the intrinsic microbes additionally contribute to the therapeutic efficacy of Arishta and Asava. Further studies are essential to demonstrate that the intrinsic microbes secrete specific compounds and contribute to the medicinal activities.
Financial support and sponsorship
The authors thank Bharathidasan University, Tiruchirappalli, India for the facilities and award of UGC for RGNF fellowship to AV. Authors are indebted to TN. Narayanan Varier and TR. Sasi Varier of Ashtanga Ayurvedics (P) Ltd, Tiruchirappalli, India.
Conflicts of interest
There are no conflicts of interest.
| References | | |
| 1. | Sekar S, Mariappan S. Fermented Medicines of Ayurveda: A Treatise. 1 st ed. Germany: LAP LAMBERT Academic Publishing; 2010. p. 1-105.  |
| 2. | Kumar KA. The need for developing new dosage presentation forms for traditional medicine. In: Paulose KG, Murali TS, Kumar NM, editors. Indian Healthcare Tradition – A Contemporary View. 1 st ed. Kottakkal: Arya Vaidya Sala; 2002. p. 120-8. |
| 3. | Sekar S, Mariappan S. Traditionally fermented biomedicines, arishtas and asavas from ayurveda. Indian J Tradit Know 2008;7:548-56. |
| 4. | Maheshwari DK, Roshan LAL. Role of micro flora associated with Dhataki flower ( Woodfordia fructicosa Kurz.) in the production of Ayurvedic tonic Amritarishta. J Indian Bot Soc 1999;78:91-4. |
| 5. | Alam M, Dasan KK, Rukmani B, Veni H, Purushothaman RG, Purushothaman KK, et al. Experimental studies on the fermentation of aravindasava. Anc Sci Life 1986;5:243-6. |
| 6. | Kroes BH, van den Berg AJ, Abeysekera AM, de Silva KT, Labadie RP. Fermentation in traditional medicine: The impact of Woodfordia fruticosa flowers on the immunomodulatory activity, and the alcohol and sugar contents of nimba arishta. J Ethnopharmacol 1993;40:117-25. |
| 7. | Santosh MK, Shaila D, Rao IS. Standardization of selected Asavas and Arishtas. Asian J Chem 2003;15:884-90. |
| 8. | Rajalakshmy MR, Sindhu A. Preliminary phytochemical screening and antioxidant activity of an ayurvedic formulation: Balarishtam. Int J Res Ayurveda Pharm 2011;2:1645-7. |
| 9. | Tiwari P, Patel RK. Total phenolics and flavonoids and antioxidant potential of draksharishta prepared by traditional and modern methods. Pharmacology online 2011;3:1072-82. |
| 10. | Chacko SM, Thambi P, Sadanandan K, Kimal A. Standardization, HPLC analysis and antioxidant study of an ayurvedic formulation-dathryarishtam. Int J Drug Discov Medi Res 2012;1:14-8. |
| 11. | Kadam PV, Yadav KN, Patel AN, Navsare VS, Narappanawar NS, Patil MJ. Comparative account of traditionally fermented biomedicine from ayurveda: Mustakarishta. Int J Res Ayurveda Pharm 2012;3:429-32. |
| 12. | Kulkarni O, Giramkar S, Ligade1 G, Narkhede A, Mukherjee S, Takle S, et al. Effect of pre – Sterilization on physicochemical parameters and in vitro free radical scavenging potential of saraswatarishta. J Pharm Res 2012;5:2657-63. |
| 13. | Vador N, Vador B, Hole R. Simple spectrophotometric methods for standardizing ayurvedic formulation. Indian J Pharm Sci 2012;74:161-3. [ PUBMED] [Full text] |
| 14. | Kumar H, Pandey PK, Doiphode VV, Vir S, Bhutani KK, Patole MS, et al. Microbial community structure at different fermentation stages of Kutajarista, a herbal formulation. Indian J Microbiol 2013;53:11-7. |
| 15. | Sailor G, Seth A, Parmar K, Patel M, Shrirang P. Standardization of marketed Drakshasava – A polyherbal ayurvedic product. Int J Pharm Sci 2013;4:363-70. |
| 16. | Lal UR, Tripathi SM, Jachak SM, Bhutani KK, Singh IP. HPLC analysis and standardization of Arjunarishta – An ayurvedic cardioprotective formulation. Sci Pharm 2009;77:605-16. |
| 17. | Singh NK, Sharma A, Sharma M, Singh R, Katiyar C. Estimation of naturally produced water-soluble vitamins in different asavas and arishtas using liquid chromatography. J Food Pharm Sci 2013;1:81-4. |
| 18. | Lal UR, Tripathi SM, Jachak SM, Bhutani KK, Singh IP. Chemical changes during fermentation of abhayarishta and its standardization by HPLC-DAD. Nat Prod Commun 2010;5:575-9. |
| 19. | Lal UR, Tripathi SM, Jachak SM, Bhutani KK, Singh IP. RP-HPLC analysis of Jirakadyarishta and chemical changes during fermentation. Nat Prod Commun 2010;5:1767-70. |
| 20. | Naumov GI. The yeast Komagataella: A genetic genus in accordance with interspecies hybridization. Microbiology 2015;84:538-43. |
| 21. | Tiwari P. Phenolics and flavonoids and antioxidant potential of balarishta prepared by traditional and modern methods. Asian J Pharm Anal 2014;4:5-10. |
| 22. | Swapna E, Mohan GK, Nagaveni P, Shanker K. Evaluation of antioxidant activity of marketed ayurvedic formulations-Balarishta. Res J Pharmacogn Phytochem 2015;7:107-10. |
| 23. | Manwar J, Mahadik K, Sathiyanarayanan L, Paradkar A, Patil S. Comparative antioxidant potential of Withania somnifera based herbal formulation prepared by traditional and non-traditional fermentation processes. Integr Med Res 2013;2:56-61. |
| 24. | Manmode R, Manwar J, Vohra M, Padgilwar S, Bhajipale N. Effect of preparation method on antioxidant activity of ayurvedic formulation kumaryasava. J Homeop Ayurv Med 2012;1:2-5. |
| 25. | Brewer MS. Natural antioxidants: sources, compounds, mechanisms of action, and potential applications. Compr Rev Food Sci Food Saf 2011;10:221-47. |
| 26. | Atlas RM. Microbiological Media. 2 nd edition. New York: CRC Press; 1946. p. 256. |
| 27. | Barnett JA, Payne RW, Yarrow D. Yeasts Characteristics and Identification. 3 rd ed. Cambridge: Cambridge University Press; 2000. p. 1150. |
| 28. | Henson OE. Dichloran as an inhibitor of mold spreading in fungal plating media: Effects on colony diameter and enumeration. Appl Environ Microbiol 1981;42:656-60. |
| 29. | White TJ, Bruns T, Lee S, Taylor JW. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Snissky JJ, White TJ, editors. PCR Protocols: A Guide to Methods and Applications. New York: Academic Press Inc.; 1990. p. 315-22. |
| 30. | Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403-10. |
| 31. | Thompson JD, Higgins DG, Gibson TJ. Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673-80. |
| 32. | Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 2013;30:2725-9. |
| 33. | Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980;16:111-20. |
| 34. | Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985;39:783-91. |
| 35. | Smibert RM, Krieg NR. Phenotypic characterization. In: Gerhardt P, Murray RG, Wood WA, Krieg NR, editors. Methods for General and Molecular Bacteriology. Rev. Edition. Washington: American Society for Microbiology; 1994. p. 611-54. |
| 36. | Ausubel FM, Brent R, Kingstons E, Moore DD, Seidman JG, Smith JA, et al. Short Protocols in Molecular Biology. 3 rd edition. New York: John Wiley & Sons Inc.; 1995. p. 836. |
| 37. | Anonymous. The Ayurvedic Pharmacopeia of India. 1 st edition. Vol. 2. New Delhi: Department of AYUSH Government of India, Ministry of Health and Family Welfare; 2008. p. 263. |
| 38. | Handa SS, Kapoor VK. Drug evaluation and standardization. In: Textbook of Pharmacognosy. 2 nd edition. New Delhi: Vallabh Prakashan; 2004. p. 73-4. |
| 39. | Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F. Colorimetric method for determination of sugars and related substances. Anal Chem 1956;28:350-6. |
| 40. | Khandelwal KR. Practical Pharmacognosy, Techniques and Experiments. 9 th ed. Pune: Nirali Prakashan; 2002. p. 149-55. |
| 41. | Blanch GP, Tabera J, Sanz J, Herraiz M, Reglero G. Volatile composition of vinegars. Simultaneous distillation-extraction and gas chromatographic-mass spectrometric analysis. J Agric Food Chem 1992;40:1046-9. |
| 42. | Xing J, Wang G, Zhang Q, Liu X, Gu Z, Zhang H, et al. Determining antioxidant activities of lactobacilli cell-free supernatants by cellular antioxidant assay: A comparison with traditional methods. PLoS One 2015;10:e0119058. |
| 43. | Sharma SK, Singh AP. In vitro antioxidant and free radical scavenging activity of Nardostachys jatamansi DC. J Acupunct Meridian Stud 2012;5:112-8. |
| 44. | Chen LS, Ma Y, Chen LJ, Zhao CH, Maubois JL, Jiang TM, et al. Antioxidant activity of two yeasts and their attenuation effect on 4-nitroquinoline 1-oxide induced in vitro lipid peroxidation. Int J Food Sci Tech 2010;45:555-61. |
| 45. | Rameshkumar A, Sivasudha T, Jeyadevi R, Sangeetha B, Ananth DA, Aseervatham GS, et al. In vitro antioxidant and antimicrobial activities of Merremia emarginata using thio glycolic acid-capped cadmium telluride quantum dots. Colloids Surf B Biointerfaces 2013;101:74-82. |
| 46. | Sharma A. Irradiation to decontaminate herbs and spices. In: Peter KV, editor. Handbook of Herbs and Spices. 1 st edition. Cambridge: Woodhead Publishing Limited; 2006. p. 60-73. |
| 47. | Alam M, Brindha P, Sarma NP, Purushothaman KK. Microbiological and chemical examination of Kumariasava. Indian J Medi Res 1975;10:49-54. |
| 48. | Kroes BH, Vandenberg AJ, Labadie RP, Abeysekera AM, Desilva KT. Impact of the preparation process on immunomodulatory activities of the ayurvedic drug Nimba-Arishta. Phytother Res 1993b; 7:35-40. |
| 49. | Patel S, Shah M. Contribution of Woodfordia fruticosa flowers in asava and arishta. In: Govil JN, Singh VK, Bhardwaj R, editors. Recent Progress in Medical Plants, Phytopharmacology and Therapeutic Values IV. 1 st ed. USA: Studium Press LLC; 2008. p. 301-10. |
| 50. | Okutsu K, Yoshimitsu M, Kakiuchi N, Mikage M. Difference in volatile compounds between tincture and ayurvedic herbal liquor asava made from ginger or jujube. J Tradit Med 2007;24:193-99. |
| 51. | Carocho M, Ferreira IC. A review on antioxidants, prooxidants and related controversy: Natural and synthetic compounds, screening and analysis methodologies and future perspectives. Food Chem Toxicol 2013;51:15-25. |
| 52. | Alam MN, Bristi NJ, Rafiquzzaman M. Review on in vivo and in vitro methods evaluation of antioxidant activity. Saudi Pharm J 2013;21:143-52. |
| 53. | Abirami A, Nagarani G, Siddhuraju P. In vitro antioxidant, anti-diabetic, cholinesterase and tyrosinase inhibitory potential of fresh juice from Citrus hystrix and C. maxima fruits. Food Sci Hum Wellness 2014;3:16-25. |
| 54. | Pavithra K, Vadivukkarasi S. Evaluation of free radical scavenging activity of various extracts of leaves from Kedrostis foetidissima (Jacq.). Cogn Food Sci Hum Wellness 2015;4:42-6. |
| 55. | Wal P, Wal A, Sharma G, Rai A. Biological activities of lupeol. Syst Rev Pharm 2011;2:96-103. [Full text] |
| 56. | Geetha T, Varalakshmi P. Anti-inflammatory activity of lupeol and lupeol linoleate in rats. J Ethnopharmacol 2001;76:77-80. |
[Figure 1], [Figure 2], [Figure 3], [Figure 4]
[Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6], [Table 7], [Table 8], [Table 9], [Table 10]
| This article has been cited by | | 1 |
Pharmacovigilance of herbal medicines: Concerns and future prospects |
|
| Abinash Choudhury, Preet Amol Singh, Neha Bajwa, Subhransu Dash, Preeti Bisht | | Journal of Ethnopharmacology. 2023; : 116383 | | [Pubmed] | [DOI] | | | 2 |
PHARMACOLOGICAL POTENTIAL OF POLYHERBAL AYURVEDIC FORMULATIONS – A REVIEW |
|
| ATHIRA R NATH, VISHESH AWASTHI, THAMARA K, SOWMYA KUMAR | | Asian Journal of Pharmaceutical and Clinical Research. 2022; : 14 | | [Pubmed] | [DOI] | | | 3 |
GC–MS and Network Pharmacology Analysis of the Ayurvedic Fermented Medicine, Chandanasava, Against Chronic Kidney and Cardiovascular Diseases |
|
| Annadurai Vinothkanna, Ragothaman Prathiviraj, Thasma Raman Sivakumar, Yongkun Ma, Soundarapandian Sekar | | Applied Biochemistry and Biotechnology. 2022; | | [Pubmed] | [DOI] | | | 4 |
Protocol based management of common sports injuries by integrated approach of Sandhi Marmabhighata - An open labeled clinical trial |
|
| Sudhanshu Sharma,Ramesh Killedar,Deepti Bagewadi,Pradeep Shindhe | | Journal of Ayurveda and Integrative Medicine. 2021; 12(1): 119 | | [Pubmed] | [DOI] | |
|
 |
|
|
|
